Detail of Probeset Mtr.47590.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.47590.1.S1_s_at
Species Medicago truncatula
Annotation 1649.m00065 /FEA=mRNA /DEF=AC144430.13 106092 104907 mth2-16j2
Mapped public sequence ID 1649.m00065
Gene Ontology GO:0000122 GO:0000785 GO:0003677 GO:0005515 GO:0005700 GO:0007307 GO:0008340 GO:0009792 GO:0030317 GO:0031523 GO:0040010 GO:0040027 GO:0040035 GO:0048477
KEGG K14905 K15963
Transporter
Transcription Factor CPP
Mapped unigene in the TRICHOME database TCMT49210  
Target sequence ggaatgagagccatgaaactgatgcttcagtagttgcagattctttcacttccgagtctc
ttatcttgacagaaaccatcg