| Detail of Probeset Mtr.47734.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.47734.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1633.m00046 /FEA=mRNA /DEF=AC138527.14 83484 83278 mth2-10a20 |
| Mapped public sequence ID |
1633.m00046 |
| Gene Ontology |
GO:0004221 GO:0005634 GO:0005829 GO:0006511 GO:0033554 GO:0045859 GO:0004427 GO:0005739 GO:0006793 |
| KEGG |
K01072 K01507 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT40149 BE940947
|
| Target sequence |
tgtttttccttgcatctcttattctcatccctcaaggctttgcttctcaacctcatcatc
atccaaaccatccactatctactcaaggatttggtgatcattctcatcctatacatccta
ccaactta |
