| Detail of Probeset Mtr.47738.1.S1_x_at in Chip AffyMedicago | |
| Probeset ID | Mtr.47738.1.S1_x_at |
| Species | Medicago truncatula |
| Annotation | 1633.m00041 /FEA=mRNA /DEF=AC138527.14 65995 64751 mth2-10a20 weakly similar to UP|Q7RQS4 (Q7RQS4) Hypothetical protein, partial (52%) |
| Mapped public sequence ID | 1633.m00041 |
| Gene Ontology | GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0005575 GO:0005634 |
| KEGG | K00140 K07497 K09873 K13663 K15001 K22300 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | caacttctgaccaacatataccttctgaccaaacaa |