| Detail of Probeset Mtr.47845.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.47845.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1621.m00052 /FEA=mRNA /DEF=AC137546.26 70876 71923 mth2-24g3 similar to TAIR|gene:2183143-GOpep .1 68412.m02145 leucine rich repeat protein family contains leucine rich repeat |
| Mapped public sequence ID |
1621.m00052 |
| Gene Ontology |
GO:0005515 GO:0005634 GO:0005737 GO:0008150 GO:0008599 GO:0030234 |
| KEGG |
K01768 K11642 K19075 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT60940 |
| Target sequence |
ggaaggcttgtcatctttagccaatctccgggttttagatgtatcatcaaataagctaac
ctctgtggatgacattcataacctaacacaattagaagatttgtggcttaatgacaacca
aatagaatcactcgaaggatttgctgaggctgtcgctggttcaagagagaagcttaccac
aatctacctagaa |
