| Detail of Probeset Mtr.47909.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.47909.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1616.m00025 /FEA=mRNA /DEF=AC136472.27 15234 14761 mth2-24f21 weakly similar to TIGR_Ath1|At1g25275-GOpep .1 68408.m02839 expressed protein, partial (93%) |
| Mapped public sequence ID |
1616.m00025 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
EV255785 BQ152839
TCMT40629 BQ150787
BQ156461 TCMT41191
|
| Target sequence |
gactgtgtttgctatgatggttttatttgtgatattttctcaaatggatagcgttgttcc
tgacgcttttgattgccttgatggttgccaaactggctgtgttcaaagagattcaaggct
taccgcaaggtgtgagcgcaagtgctctattagatgcggtccagattctatgtttga |