| Detail of Probeset Mtr.47909.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.47909.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1616.m00025 /FEA=mRNA /DEF=AC136472.27 15234 14761 mth2-24f21 weakly similar to TIGR_Ath1|At1g25275-GOpep .1 68408.m02839 expressed protein, partial (93%) |
| Mapped public sequence ID | 1616.m00025 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | EV255785 BQ152839 TCMT40629 BQ150787 BQ156461 TCMT41191 |
| Target sequence | gactgtgtttgctatgatggttttatttgtgatattttctcaaatggatagcgttgttcc |