| Detail of Probeset Mtr.47934.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.47934.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1613.m00049 /FEA=mRNA /DEF=AC135800.23 58540 57829 mth2-14g8 similar to TAIR|gene:1005832588-GOpep .1 68412.m05541 amino acid permease 6 (AAP6) identical to amino acid permease 6 |
| Mapped public sequence ID |
1613.m00049 |
| Gene Ontology |
GO:0000329 GO:0005215 GO:0005302 GO:0015186 GO:0015188 GO:0032974 |
| KEGG |
K10461 |
| Transporter |
2.A.18 2.A.18.2.1 2.A.18.2.4 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ttggcatcttgactacaacaatgttttatatgctatgtggctgcttaggttatgcagcat
ttggaaatgatgcaccagggaatttcctcacagggttcggcttctacgagccgttttggc
taatcgacttagccaacatcttcatcgccgtgcacttaattggagcatatcaggttttct
gccaaccaatctttggattcgtagaga |
