Detail of Probeset Mtr.47993.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.47993.1.S1_at |
Species |
Medicago truncatula |
Annotation |
1608.m00022 /FEA=mRNA /DEF=AC135413.35 11865 14930 mth2-16n19 weakly similar to TIGR_Ath1|At5g25590-GOpep .1 68412.m02783 expressed protein various predicted proteins, Arabidopsis, partial (66%) |
Mapped public sequence ID |
1608.m00022 |
Gene Ontology |
|
KEGG |
|
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
gaagcattacatccaagctctttttagctggctcaagttaaatctcattcccatcgaaag
c |