| Detail of Probeset Mtr.4817.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.4817.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
AL385054 /FEA=mRNA /DEF=weakly similar to UP|Q6BW48 (Q6BW48) Debaryomyces hansenii chromosome B of strain CBS767 of Debaryomyces hansenii, partial (35%) |
| Mapped public sequence ID |
AL385054 |
| Gene Ontology |
GO:0005094 GO:0005634 GO:0005829 GO:0005856 GO:0006916 GO:0006928 GO:0007015 GO:0007162 GO:0007264 GO:0007266 GO:0042802 |
| KEGG |
K16712 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
AL385054 |
| Target sequence |
agaaatgattggaagttacggcccaaacatcgaaccttacgaaaagaaattcatggttga
agaagctcccagcggtatgcttgcacgtggacattatgatgcaaagagcaaatttatcga
tgatgataacgtcacccacattgaatggtcctggtcttttgatatcaa |
