| Detail of Probeset Mtr.48222.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.48222.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1584.m00033 /FEA=mRNA /DEF=AC127674.21 17841 18232 mth2-20a12 similar to UP|Q9M9G4 (Q9M9G4) F14O23.20 protein |
| Mapped public sequence ID |
1584.m00033 |
| Gene Ontology |
GO:0000131 GO:0000145 GO:0000910 GO:0002119 GO:0005515 GO:0005934 GO:0005935 GO:0006893 GO:0006904 GO:0006906 GO:0007121 GO:0040007 GO:0040010 GO:0040011 GO:0043332 GO:0002168 GO:0005915 GO:0007009 GO:0007269 GO:0008594 GO:0015031 GO:0016028 GO:0016080 GO:0016081 GO:0016192 GO:0042052 GO:0045313 GO:0045494 GO:0045921 |
| KEGG |
K06110 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT60555 |
| Target sequence |
aggatctcggtgttgaagcgaaagaagcatctgttcgtgaagttgcgaaactgttgcctc
ttccggagcttcttcagtcaattgcatcgatcaaagccgattacatttctcgtcaacag |