Detail of Probeset Mtr.48263.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.48263.1.S1_s_at
Species Medicago truncatula
Annotation 1581.m00050 /FEA=mRNA /DEF=AC126783.24 89957 90599 mth2-15k17
Mapped public sequence ID 1581.m00050
Gene Ontology GO:0006508 GO:0005215 GO:0005524 GO:0006810 GO:0016021 GO:0042626 GO:0005575 GO:0005634 GO:0008150 GO:0033554
KEGG K01342 K01362 K05658 K05660 K07497 K15001 K18599 K19402
Transporter 3.A.1 3.A.1.201 3.A.1.201.1 3.A.1.201.3
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence attcaagccaagatttgttgagacatcatggatcttgtcatggaatcttca