| Detail of Probeset Mtr.48372.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.48372.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1570.m00048 /FEA=mRNA /DEF=AC122724.28 112842 120233 mth2-14m14 weakly similar to TIGR_Ath1|At3g01150-GOpep .1 68410.m00017 polypyrimidine tract-binding protein 1 (PTB) (heterogeneous, complete |
| Mapped public sequence ID | 1570.m00048 |
| Gene Ontology | GO:0000398 GO:0005515 GO:0005634 GO:0005654 GO:0005730 GO:0008187 GO:0008380 GO:0030530 |
| KEGG | K10936 K15699 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | cggtgcttttcctggtagtcaacctcattatggttgggaaa |