| Detail of Probeset Mtr.48638.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.48638.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1264.m00016 /FEA=mRNA /DEF=LQGC hypothetical protein AC151481.4.151 86508 86350 mth2-3m11 01/13/05 |
| Mapped public sequence ID |
IMGAG|1264.m00016 |
| Gene Ontology |
GO:0000028 GO:0004012 GO:0005524 GO:0005802 GO:0006886 GO:0006892 GO:0006897 GO:0015662 GO:0015917 GO:0016021 GO:0016192 GO:0019829 GO:0045332 GO:0055085 |
| KEGG |
K01530 |
| Transporter |
3.A.3 3.A.3.8.1 3.A.3.8.2 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
aagaggccggaacttcattgattgaccgagctacaaaactacgtcaaagaacagcacatg
tagaatgcaaaccaaacctacttggagcaactagagttgagaggacaagctgcaa |
