Detail of Probeset Mtr.48789.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.48789.1.S1_s_at
Species Medicago truncatula
Annotation IMGAG|1251.m00006 /FEA=mRNA /DEF=At1g69870/T17F3_10-related AC149489.2.61 40310 39584 mth2-24b4 01/13/05
Mapped public sequence ID IMGAG|1251.m00006
Gene Ontology GO:0005290 GO:0005427 GO:0005765 GO:0015817 GO:0030163 GO:0005624 GO:0006857 GO:0016021 GO:0016248 GO:0042936 GO:0051956
KEGG K03305
Transporter 2.A.17 2.A.17.3.2 2.A.17.3.3 2.A.17.3.1
Transcription Factor
Mapped unigene in the TRICHOME database AW693370  TCMT47444  
Target sequence gttgacgatgatgaaatggtttctcaacaacctcaaagacgcaagggtggtcttatcacc
atgcctttcatcattgctaatgaggcacttgcaaggatggcaagtttgggactattgccc
aatatgatattgtatttcatgggaagttacaggcttcatcttgccaaagctactcagatt
cttc