Detail of Probeset Mtr.48820.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.48820.1.S1_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|1149.m00023 /FEA=mRNA /DEF=hypothetical protein AC146865.11.221 110116 109686 mth2-36m14 01/13/05 |
Mapped public sequence ID |
IMGAG|1149.m00023 |
Gene Ontology |
GO:0004602 GO:0005634 GO:0005737 GO:0006412 GO:0006750 GO:0006979 GO:0009636 GO:0045454 GO:0047066 |
KEGG |
K00432 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
atgggtgctacacaatcagtcttggaaaattctattcatgaatacaaagtcaaggatgca
aggggcaaagaagtgaaccttggtatctacagagggaaagttcttcttgtagtt |