| Detail of Probeset Mtr.48873.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.48873.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1247.m00008 /FEA=mRNA /DEF=Acid phosphatase (Class B); Plant acid phosphatase AC149269.11.81 38959 42019 mth2-102b19 01/13/05 |
| Mapped public sequence ID | IMGAG|1247.m00008 |
| Gene Ontology | GO:0003993 GO:0008152 |
| KEGG | K01078 K02866 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT54072 |
| Target sequence | gtgccttattatcaagacgttggatttgggtcaaaaatcttcaatgagacatccttcaat |