Detail of Probeset Mtr.48912.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.48912.1.S1_s_at
Species Medicago truncatula
Annotation IMGAG|757.m00012 /FEA=mRNA /DEF=Retinal pigment epithelial membrane protein AC123596.13.121 43978 45252 mth1-17n5 01/13/05
Mapped public sequence ID IMGAG|757.m00012
Gene Ontology GO:0003674 GO:0005575 GO:0008150 GO:0008152 GO:0016702
KEGG K09840
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence gggaacagtgacattggtagcaacgaatattttgtcagtgcagcatgtgatggagagaat
ggaccttattcatgccatgattgaga