| Detail of Probeset Mtr.48922.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.48922.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|742.m00004 /FEA=mRNA /DEF=hypothetical retrovirus-related pol polyprotein AT4g22040 - Arabidopsis thaliana-related AC122169.23.31 22920 18712 mth2-9m5 01/13/05 |
| Mapped public sequence ID |
IMGAG|742.m00004 |
| Gene Ontology |
GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 |
| KEGG |
K00140 K13663 K15001 K22300 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
acattttcactaaaagtttgacacgtcagcggcacaattttctacttggcaaattgatgc
ttgtagatttaccag |
