| Detail of Probeset Mtr.4912.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.4912.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
AL389198 /FEA=mRNA /DEF=weakly similar to PIR|I38344|I3 titin cardiac muscle [validated] - human {Homo sapiens;}, partial (0%) |
| Mapped public sequence ID |
AL389198 |
| Gene Ontology |
GO:0004565 GO:0005515 GO:0005990 |
| KEGG |
K01190 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
AL389198 BQ149806
TCMT58167 |
| Target sequence |
ataataaactccaaaacagcgttcgttctggtgattgttttggatttttctttggcgccc
gtaggcataactattgcaattccgacggg |