| Detail of Probeset Mtr.49125.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.49125.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|867.m00022 /FEA=mRNA /DEF=hypothetical protein AC135320.6.211 102367 98423 mth2-28e9 01/13/05 |
| Mapped public sequence ID | IMGAG|867.m00022 |
| Gene Ontology | GO:0004124 GO:0006535 GO:0019344 GO:0002119 GO:0005515 GO:0007052 GO:0009792 GO:0040010 GO:0040011 |
| KEGG | K00924 K01738 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | EX523340 TCMT40324 BT052488 |
| Target sequence | cctgccaatcccaaggtacattatgaaaccaccggtccagagatatggaaaggcacggat |