| Detail of Probeset Mtr.49152.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.49152.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|789.m00022 /FEA=mRNA /DEF=probable helicase [imported] - Arabidopsis thaliana-related AC125481.22.221 91789 93416 mth2-15n13 01/13/05 |
| Mapped public sequence ID |
IMGAG|789.m00022 |
| Gene Ontology |
GO:0000287 GO:0000784 GO:0003678 GO:0005524 GO:0005634 GO:0005739 GO:0017116 GO:0032204 GO:0033682 GO:0042162 GO:0043141 GO:0051276 GO:0051974 |
| KEGG |
K01529 K16158 K20225 K23961 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
cgtgataagtccaagccggttgatgaaataaagcagtattacgattgtcgttatgtttca
ccttgcgaggctgtttggaggatatttgcttttgatataca |
