Detail of Probeset Mtr.49182.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.49182.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1021.m00015 /FEA=mRNA /DEF=Oligopeptide transporter OPT superfamily; Ribosomal protein S2; Tetrapeptide transporter, OPT1/isp4 AC143341.8.141 79786 83011 mth2-7a11 01/13/05
Mapped public sequence ID IMGAG|1021.m00015
Gene Ontology GO:0000747 GO:0005783 GO:0006857 GO:0015197 GO:0015198 GO:0016021 GO:0019740 GO:0031142 GO:0042493
KEGG
Transporter 2.A.67 2.A.67.1.1 2.A.67.1.2
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence ttggtctacttgcacctgttccagtgtggcttctttctctcaaatttcgtaaccaaaagt
ggattcaactcattaacattcctattatcgccgcaggtgcatctggcattccaccagtga
gatctgtgaa