| Detail of Probeset Mtr.49331.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.49331.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|745.m00019 /FEA=mRNA /DEF=Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen AC122722.6.191 99718 97833 mth1-3f12 01/13/05 |
| Mapped public sequence ID | IMGAG|745.m00019 |
| Gene Ontology | GO:0006800 GO:0006979 GO:0016209 GO:0016491 GO:0045335 |
| KEGG | K00428 K00435 K03386 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40506 TCMT40052 TCMT42748 |
| Target sequence | gatgtgatcccagatggcaccttagccttccttgatgaagaaaacaaacctcaatctgtc |