| Detail of Probeset Mtr.49341.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.49341.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1025.m00005 /FEA=mRNA /DEF=Peptidase, metallopeptidases; Peptidoglycan binding-like; Peptidase M, neutral zinc metallopeptidases, zinc-binding site; Peptidase M10A and M12B, matrixin and adamalysin AC144345.18.41 18559 19665 mth2-25i7 01/13/05 |
| Mapped public sequence ID |
IMGAG|1025.m00005 |
| Gene Ontology |
GO:0004222 GO:0005515 GO:0005615 GO:0006508 GO:0008270 GO:0070173 |
| KEGG |
K01417 K07761 K07999 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
accatggtgacggagaagcatttgacggagtccttggaacattagcacacgctttttcac
caactgacggaagatt |
