| Detail of Probeset Mtr.49483.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.49483.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1028.m00005 /FEA=mRNA /DEF=hypothetical protein AC144431.11.41 16597 16048 mth2-21i14 01/13/05 |
| Mapped public sequence ID |
IMGAG|1028.m00005 |
| Gene Ontology |
GO:0001666 GO:0003700 GO:0003713 GO:0004402 GO:0004871 GO:0005634 GO:0005730 GO:0005737 GO:0006355 GO:0006461 GO:0006915 GO:0007165 GO:0007399 GO:0008022 GO:0016407 GO:0016573 GO:0018076 GO:0042592 GO:0045941 GO:0051091 GO:0051577 |
| KEGG |
K04498 |
| Transporter |
|
| Transcription Factor |
TAZ |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atgatatctcctccaacactaaacataatgatatcgtccttgagagtagattgtttggaa
atagggacaactttttgatcttctgccagaa |
