Detail of Probeset Mtr.49483.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.49483.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1028.m00005 /FEA=mRNA /DEF=hypothetical protein AC144431.11.41 16597 16048 mth2-21i14 01/13/05
Mapped public sequence ID IMGAG|1028.m00005
Gene Ontology GO:0001666 GO:0003700 GO:0003713 GO:0004402 GO:0004871 GO:0005634 GO:0005730 GO:0005737 GO:0006355 GO:0006461 GO:0006915 GO:0007165 GO:0007399 GO:0008022 GO:0016407 GO:0016573 GO:0018076 GO:0042592 GO:0045941 GO:0051091 GO:0051577
KEGG K04498
Transporter
Transcription Factor TAZ
Mapped unigene in the TRICHOME database N/A
Target sequence atgatatctcctccaacactaaacataatgatatcgtccttgagagtagattgtttggaa
atagggacaactttttgatcttctgccagaa