| Detail of Probeset Mtr.49546.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.49546.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1106.m00001 /FEA=mRNA /DEF=Protein kinase; Serine/threonine protein kinase, active site; Protein kinase-like; Leucine-rich repeat; Leucine-rich repeat, typical subtype; Tyrosine protein kinase; Leucine-rich repeat, plant specific AC146586.2.11 2659 |
| Mapped public sequence ID |
IMGAG|1106.m00001 |
| Gene Ontology |
GO:0004674 GO:0005515 GO:0005887 |
| KEGG |
K00924 |
| Transporter |
1.A.26 1.A.26.1.1 |
| Transcription Factor |
WRKY |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
acttgatgagaacctgaatgcaaagattgctgattttggtctaagtaaagcttttggtaa
cgatgatgattctcatatatccacacgccctgctggtacatttggctacgttgatccatt
tcagataccaggaaacacaaa |