| Detail of Probeset Mtr.49556.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.49556.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1207.m00008 /FEA=mRNA /DEF=RNA polymerase Rpb1, domain 1; RNA polymerase, alpha subunit; RNA polymerase Rpb1, domain 3; RNA polymerase Rpb1, domain 4; RNA polymerase Rpb1, domain 5; RNA polymerase I subunit A, N-terminal AC148348.6.71 36134 51814 m |
| Mapped public sequence ID |
IMGAG|1207.m00008 |
| Gene Ontology |
GO:0003899 GO:0005736 GO:0005829 GO:0006360 GO:0006406 GO:0007000 GO:0034503 |
| KEGG |
K02999 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gctcagattgctcagagaacagccgagaaggtttgtatccagaactttggtaaggttggc
caatgtaaagctattacatgtaaagaaagtggcgtaatctactatggtgaagatga |