| Detail of Probeset Mtr.49572.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.49572.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1104.m00016 /FEA=mRNA /DEF=Naringenin-chalcone synthase; Type III polyketide synthase AC146575.3.161 92557 91179 mth2-145m4 01/13/05 |
| Mapped public sequence ID | IMGAG|1104.m00016 |
| Gene Ontology | GO:0005575 GO:0008415 GO:0009813 GO:0016210 |
| KEGG | K00660 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40746 U01020 TCMT46303 |
| Target sequence | tgaagttactgcagtgacattccgtggtcctagtgat |