| Detail of Probeset Mtr.49583.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.49583.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1205.m00017 /FEA=mRNA /DEF=Glycoside hydrolase, family 28; Regulator of chromosome condensation, RCC1; Parallel beta-helix repeat; Pectin lyase-like AC148340.3.171 70105 73268 mth2-22d10 01/13/05 |
| Mapped public sequence ID |
IMGAG|1205.m00017 |
| Gene Ontology |
GO:0004650 GO:0005575 GO:0005576 GO:0007124 GO:0009636 GO:0019863 GO:0045490 GO:0047911 |
| KEGG |
K01184 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
acaggtgatgactgcatctccatagtcagaaattcttcacgggtctggatccgaaatatt
tcctgtggtccaggtcatggcataagcattggtagcttaggaaaatcaaacgtatgggag
aagattcaaaatgtaattgttgatggagcttatctttacaacactgataatggggtgaga
atcaaaacatggcagggtgggagtggttttgcctccaagatcacattccagaata |