| Detail of Probeset Mtr.49862.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.49862.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1089.m00019 /FEA=mRNA /DEF=isoflavone-7-o-methytransferase 9 (ec 2.1.1.150) (isoflavone-o-methytransferase 9) (7 iomt-9) AC146549.6.191 63403 65050 mth2-7p18 01/13/05 |
| Mapped public sequence ID | IMGAG|1089.m00019 |
| Gene Ontology | GO:0005575 GO:0008150 GO:0008168 GO:0008171 GO:0019438 |
| KEGG | K00543 K00599 K05279 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS41082 AF023481 TCMT46988 DW018810 |
| Target sequence | acttggcattgagagattgtgattttgtgtttgatggattggaatcaattgtggatgttg |