| Detail of Probeset Mtr.49894.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.49894.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1088.m00017 /FEA=mRNA /DEF=ABC transporter, putative AC146548.9.171 86510 78325 mth2-2p3 01/13/05 |
| Mapped public sequence ID |
IMGAG|1088.m00017 |
| Gene Ontology |
GO:0005524 GO:0006810 GO:0016021 GO:0042626 GO:0043190 GO:0005794 GO:0015918 |
| KEGG |
K05643 K05648 K05650 K05651 K10827 K10834 |
| Transporter |
3.A.1 3.A.1.211 3.A.1.211.2 3.A.1.211.3 3.A.1.211.4 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
AL389608 |
| Target sequence |
ttttgtaaatggtagcttgcagtgtgtaggaaatccaaaggagctgaaagccaggtatgg
agggatttatgtgttcacaatgacaacatcttccgatcacgagaaggatgtggagaacat
tgtgcaacagctcaccccaaatgc |