| Detail of Probeset Mtr.499.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.499.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | 1444.m00029 /FEA=mRNA /DEF=AC146630.25 13961 12061 mth2-7f22 weakly similar to UP|Q8LEZ1 (Q8LEZ1) Hypothetical protein |
| Mapped public sequence ID | 1444.m00029 |
| Gene Ontology | GO:0003674 GO:0008150 |
| KEGG | K11449 K19544 K22196 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT57124 |
| Target sequence | cttatattgcttctcggatatgcatatcctggatttgaatgctacaaaaccgttgagaga |