| Detail of Probeset Mtr.49963.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.49963.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1190.m00002 /FEA=mRNA /DEF=HCO3-transporter AC148176.11.11 9003 12212 mth2-3j15 01/13/05 |
| Mapped public sequence ID |
IMGAG|1190.m00002 |
| Gene Ontology |
GO:0000324 GO:0005624 GO:0005773 GO:0005886 GO:0006623 GO:0006810 GO:0008509 GO:0018193 GO:0046713 GO:0046714 GO:0046715 |
| KEGG |
K06573 |
| Transporter |
2.A.31 2.A.31.3.1 2.A.31.3.2 2.A.31.1.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT51511 |
| Target sequence |
acatggcaatagatagtcttccggggaatcagttctgggaaaggatattgctcctctttg
tcaccccaagccggcgtttcaaaatattgcaagatacacatgcctcatttgtggagacag
taccattcaagaccatagctggatttacagccttacagttggcatattttctgttctgtt
tcggggtcacatggataccgataggtgga |
