Detail of Probeset Mtr.50080.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.50080.1.S1_s_at
Species Medicago truncatula
Annotation IMGAG|985.m00028 /FEA=mRNA /DEF=LQGC hypothetical protein AC140720.21.271 117216 117841 mth2-17l10 01/13/05
Mapped public sequence ID IMGAG|985.m00028
Gene Ontology GO:0005575 GO:0005634 GO:0003677 GO:0004386 GO:0005515 GO:0005524 GO:0005654 GO:0005667 GO:0006302 GO:0006357 GO:0008094 GO:0010552 GO:0016251 GO:0016514 GO:0042766 GO:0043044 GO:0045893 GO:0002119 GO:0009792 GO:0015992 GO:0016021 GO:0018996 GO:0040007 GO:0040010 GO:0040011 GO:0040035 GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0008233 GO:0032197 GO:0033554
KEGG K00517 K02155 K07497 K11647 K22300
Transporter 3.A.2 3.A.2.2.3 9.B.16.1.1
Transcription Factor PHD
Mapped unigene in the TRICHOME database N/A
Target sequence gcattcttggcctctaattctcatgctttaacaa