| Detail of Probeset Mtr.50300.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.50300.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1071.m00006 /FEA=mRNA /DEF=hypothetical protein AC144893.15.61 36752 36516 mth2-29d23 01/13/05 |
| Mapped public sequence ID |
IMGAG|1071.m00006 |
| Gene Ontology |
GO:0000793 GO:0003677 GO:0004672 GO:0005634 GO:0006357 GO:0042393 |
| KEGG |
K11721 K11722 K16089 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
AL389255 |
| Target sequence |
aagagtagatcaagtagttcaagcagtgattctgggtcttcttcaagtgattctgatagt
gacagttcctcatcctctggatctgatgcagggtcacgaggaacttga |
