| Detail of Probeset Mtr.50309.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.50309.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1069.m00016 /FEA=mRNA /DEF=conserved hypothetical protein AC144806.10.151 111651 111433 mth2-34h22 01/13/05 |
| Mapped public sequence ID | IMGAG|1069.m00016 |
| Gene Ontology | GO:0006508 GO:0006510 GO:0009368 |
| KEGG | K01358 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT56127 BQ150808 TCMT56128 TCMT56126 |
| Target sequence | tgctacttctttgtatgagggacaagtaggagaatgtatgctggaagcggaggaattact |