Detail of Probeset Mtr.50319.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.50319.1.S1_at
Species Medicago truncatula
Annotation IMGAG|976.m00001 /FEA=mRNA /DEF=EXS, C-terminal AC140544.19.11 1243 5282 mth2-17g16 01/13/05
Mapped public sequence ID IMGAG|976.m00001
Gene Ontology GO:0003674 GO:0004930 GO:0005886 GO:0005887 GO:0007186 GO:0008150 GO:0016021
KEGG K15208 K17527 K25858
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence attgttgctatcactccattttggatccgttttctt