| Detail of Probeset Mtr.50381.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.50381.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|973.m00011 /FEA=mRNA /DEF=Ribosomal protein S19/S15; Ribosomal protein S15, eukaryotic and archaeal form AC140035.9.111 45160 43661 mth2-25n18 01/13/05 |
| Mapped public sequence ID | IMGAG|973.m00011 |
| Gene Ontology | GO:0000022 GO:0003735 GO:0005811 GO:0006412 GO:0007052 GO:0009790 GO:0022627 |
| KEGG | K02958 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40263 TCMT49565 TCMT49564 |
| Target sequence | tgaggtagatgcagcagcagccgccgccggagtaccgaagaagagaacattcaagaagtt |