| Detail of Probeset Mtr.50437.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.50437.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|969.m00013 /FEA=mRNA /DEF=hypothetical protein AC140030.6.121 71028 70864 mth2-7g24 01/13/05 |
| Mapped public sequence ID |
IMGAG|969.m00013 |
| Gene Ontology |
GO:0003674 GO:0005783 GO:0006811 GO:0008150 GO:0008381 GO:0016020 GO:0016021 GO:0033554 |
| KEGG |
K03442 |
| Transporter |
1.A.23 1.A.23.4.2 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ggagaggagagcacttgctttgacattgaatgacaccaaaaccgcagtgaataaacttca
tcgaatgctcaatttcttagtt |
