| Detail of Probeset Mtr.50490.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.50490.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|967.m00006 /FEA=mRNA /DEF=Eukaryotic protein of unknown function DUF889 AC140027.11.61 37387 36033 mth2-5m21 01/13/05 |
| Mapped public sequence ID | IMGAG|967.m00006 |
| Gene Ontology | GO:0000287 GO:0000784 GO:0003678 GO:0005524 GO:0005634 GO:0005739 GO:0017116 GO:0032204 GO:0033682 GO:0042162 GO:0043141 GO:0051276 GO:0051974 |
| KEGG | K01529 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gcaaagaagtactcaagactctggttcatgacaaggaggaaaa |