| Detail of Probeset Mtr.50501.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.50501.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1057.m00016 /FEA=mRNA /DEF=Major intrinsic protein AC144721.16.161 72361 70388 mth2-11o23 01/13/05 |
| Mapped public sequence ID | IMGAG|1057.m00016 |
| Gene Ontology | GO:0005887 GO:0006833 GO:0015250 GO:0015288 GO:0016020 GO:0030104 GO:0051260 |
| KEGG | K09873 |
| Transporter | 1.A.8 1.A.8.10.1 1.A.8.10.2 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40715 EX521611 TCMT49530 EV255448 |
| Target sequence | gatccagcagggttactagcagttgctgtttgccatggttttgcactttttgttgctgtt |