Detail of Probeset Mtr.50689.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.50689.1.S1_s_at
Species Medicago truncatula
Annotation IMGAG|1045.m00022 /FEA=mRNA /DEF=RNase H AC144564.12.211 80647 81108 mth2-17n4 01/13/05
Mapped public sequence ID IMGAG|1045.m00022
Gene Ontology GO:0000287 GO:0000784 GO:0003678 GO:0005524 GO:0005634 GO:0005739 GO:0017116 GO:0032204 GO:0033682 GO:0042162 GO:0043141 GO:0051276 GO:0051974 GO:0003674 GO:0005575 GO:0008150
KEGG K01529 K03469 K11252 K23961
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence atggcttggagggaacattactctcatcttatagtgg