Detail of Probeset Mtr.50689.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.50689.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|1045.m00022 /FEA=mRNA /DEF=RNase H AC144564.12.211 80647 81108 mth2-17n4 01/13/05 |
Mapped public sequence ID |
IMGAG|1045.m00022 |
Gene Ontology |
GO:0000287 GO:0000784 GO:0003678 GO:0005524 GO:0005634 GO:0005739 GO:0017116 GO:0032204 GO:0033682 GO:0042162 GO:0043141 GO:0051276 GO:0051974 GO:0003674 GO:0005575 GO:0008150 |
KEGG |
K01529 K03469 K11252 K23961 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
atggcttggagggaacattactctcatcttatagtgg |