| Detail of Probeset Mtr.50753.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.50753.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|957.m00015 /FEA=mRNA /DEF=Mitochondrial carrier protein; Adenine nucleotide translocator 1; Calcium-binding EF-hand; Mitochondrial substrate carrier AC139708.15.141 74651 77664 mth2-9f16 01/13/05 |
| Mapped public sequence ID |
IMGAG|957.m00015 |
| Gene Ontology |
GO:0005347 GO:0005488 GO:0005509 GO:0005739 GO:0005740 GO:0005743 GO:0005778 GO:0006810 GO:0006817 GO:0015114 GO:0015217 GO:0015866 GO:0015867 GO:0022857 |
| KEGG |
K20580 K22721 |
| Transporter |
2.A.29 2.A.29.23.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT53183 |
| Target sequence |
gaggctcaagggaacaattcggatattggtgctgctgggaggcttttagcaggtggcgtg
gctggtggaattgcgcagaccgcaatttatcctatggaccttatcaaaactaggctacaa
acttgtgcttctgaaggtggaagggctcctaaact |
