| Detail of Probeset Mtr.50765.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.50765.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1040.m00011 /FEA=mRNA /DEF=Hydantoinaseoxoprolinase, N-terminal; Hydantoinase/oxoprolinase; Hydantoinase B/oxoprolinase AC144517.7.101 44994 41194 mth2-13k17 01/13/05 |
| Mapped public sequence ID |
IMGAG|1040.m00011 |
| Gene Ontology |
GO:0005575 GO:0008150 GO:0016787 GO:0017168 |
| KEGG |
K01469 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
attcatattccagaaggctcatttctttctcctagtgatagtgcagctgtagtaggaggc
aatgtccttacatctcagagaatcaccgatgttgtatttactgcatttcaggctt |