| Detail of Probeset Mtr.50770.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.50770.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|956.m00019 /FEA=mRNA /DEF=Small GTP-binding protein domain; Ras GTPase; ADP-ribosylation factor; GTP-binding nuclear protein Ran; Ras small GTPase, Rab type; Ras small GTPase, Rho type; Ras small GTPase, Ras type AC139707.10.191 108984 107086 mth2- |
| Mapped public sequence ID |
IMGAG|956.m00019 |
| Gene Ontology |
GO:0000331 GO:0005525 GO:0005575 GO:0007264 GO:0015031 GO:0016339 GO:0030036 GO:0031157 GO:0032794 GO:0033298 GO:0050708 |
| KEGG |
K07976 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tcccttcttctacgtttctctgatagctatttcacaactagttatattacaacactaggc
attgattataagaatagagccattgagctggatggaaaaaagatcatgctccaagtttgg
gatactgcaggtcaggagcggttccgaacaattacaaccgcttactatcgtggtgctatg
ggcatattgctggtctatgatgttacagatgaatcttcatttaacaatatcacgaattgg
attcgtagcattgag |
