| Detail of Probeset Mtr.50786.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.50786.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1038.m00012 /FEA=mRNA /DEF=Zn-finger, C2H2 type AC144515.14.111 31704 32144 mth2-5j8 01/13/05 |
| Mapped public sequence ID |
IMGAG|1038.m00012 |
| Gene Ontology |
GO:0007399 GO:0007411 GO:0007413 GO:0007626 GO:0008270 GO:0016358 GO:0016564 GO:0021536 GO:0021854 GO:0030900 GO:0008150 |
| KEGG |
K03540 K09228 K10498 |
| Transporter |
|
| Transcription Factor |
C2H2 |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ctgtcaaaggtgattggaggactcatgaaaagaattgtggcaagttatggtattgcactt
gtggttcagattttaaacacaaaagatctctcaaagatcatattaggtctttcggaaaag
gtcatcgtcgtctttcctcgattgatgatcgagttttcgagga |