| Detail of Probeset Mtr.50943.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.50943.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|764.m00012 /FEA=mRNA /DEF=PDZ/DHR/GLGF; Peptidase, trypsin-like serine and cysteine proteases; Peptidase S1, chymotrypsin; Peptidase S1C, hrtA/degQ AC124951.19.111 109674 103495 mth2-7p23 01/13/05 |
| Mapped public sequence ID | IMGAG|764.m00012 |
| Gene Ontology | GO:0005515 GO:0006508 GO:0008233 |
| KEGG | K01362 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT53097 |
| Target sequence | ggacttgaccacactcttacaactggagtcattagtggacttcggcg |