Detail of Probeset Mtr.50943.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.50943.1.S1_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|764.m00012 /FEA=mRNA /DEF=PDZ/DHR/GLGF; Peptidase, trypsin-like serine and cysteine proteases; Peptidase S1, chymotrypsin; Peptidase S1C, hrtA/degQ AC124951.19.111 109674 103495 mth2-7p23 01/13/05 |
Mapped public sequence ID |
IMGAG|764.m00012 |
Gene Ontology |
GO:0005515 GO:0006508 GO:0008233 |
KEGG |
K01362 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT53097 |
Target sequence |
ggacttgaccacactcttacaactggagtcattagtggacttcggcg |