Detail of Probeset Mtr.50993.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.50993.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|729.m00003 /FEA=mRNA /DEF=Parallel beta-helix repeat; Pectin lyase-like; Glycoside hydrolase, family 28 AC121237.19.21 10176 7659 mth2-22g11 01/13/05 |
Mapped public sequence ID |
IMGAG|729.m00003 |
Gene Ontology |
GO:0004650 GO:0005575 GO:0005576 GO:0007124 GO:0009636 GO:0019863 GO:0045490 GO:0047911 GO:0005515 |
KEGG |
K01184 K01213 K01238 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
ttggatgacaggttcttatggagatcatcctgataacggatttgatccaaacgcattgcc
taaaattagtggaataaattatagagatgtcaccgctaagaatgtgact |