| Detail of Probeset Mtr.51126.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.51126.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|832.m00012 /FEA=mRNA /DEF=LQGC hypothetical protein AC130805.15.121 51676 51849 mth2-9n1 01/13/05 |
| Mapped public sequence ID |
IMGAG|832.m00012 |
| Gene Ontology |
GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 |
| KEGG |
K07497 K15001 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
acaaccagaatgtacttgcttgagtgtttgtgcgatctgtgtcggacgtgttgatcaaga
gcgaacccctagttggtatt |