| Detail of Probeset Mtr.51128.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.51128.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|729.m00023 /FEA=mRNA /DEF=AAA ATPase; Ras GTPase; Conserved hypothetical ATP binding protein AC121237.19.221 104271 101287 mth2-22g11 01/13/05 |
| Mapped public sequence ID | IMGAG|729.m00023 |
| Gene Ontology | GO:0005515 GO:0005525 GO:0005575 GO:0007264 GO:0017111 |
| KEGG | K06883 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT53545 |
| Target sequence | agcacaacatgagtttgccttggagtggatgaa |