Detail of Probeset Mtr.51135.1.S1_x_at in Chip AffyMedicago |
Probeset ID |
Mtr.51135.1.S1_x_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|766.m00005 /FEA=mRNA /DEF=hypothetical protein AC124953.32.41 20558 20719 mth2-6f8 01/13/05 |
Mapped public sequence ID |
IMGAG|766.m00005 |
Gene Ontology |
GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0005739 GO:0008233 GO:0032197 GO:0005575 GO:0005634 |
KEGG |
K07497 K15001 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
gcaaaatccagtgccatattcgtgttcagaacaaaa |