| Detail of Probeset Mtr.51135.1.S1_x_at in Chip AffyMedicago | |
| Probeset ID | Mtr.51135.1.S1_x_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|766.m00005 /FEA=mRNA /DEF=hypothetical protein AC124953.32.41 20558 20719 mth2-6f8 01/13/05 |
| Mapped public sequence ID | IMGAG|766.m00005 |
| Gene Ontology | GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0005739 GO:0008233 GO:0032197 GO:0005575 GO:0005634 |
| KEGG | K07497 K15001 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gcaaaatccagtgccatattcgtgttcagaacaaaa |